View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4542-Insertion-1 (Length: 206)
Name: NF4542-Insertion-1
Description: NF4542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4542-Insertion-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 97 - 206
Target Start/End: Original strand, 18841976 - 18842085
Alignment:
| Q |
97 |
gactataaagtaaacaagggaagaaatttcttcaaggtttctgttgataacacattttcaattgtcaaaaagtacattttaatgccagaaacaaaggaat |
196 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18841976 |
gactataaagtaaacaagggaagaagtttcttcaagctttctgttgaaaacacatttaaaattgtcaaaaagtacattttaatgccagaaacaaaggaat |
18842075 |
T |
|
| Q |
197 |
tgatcttgca |
206 |
Q |
| |
|
|||||||||| |
|
|
| T |
18842076 |
tgatcttgca |
18842085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University