View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4542_high_11 (Length: 237)
Name: NF4542_high_11
Description: NF4542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4542_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 134 - 222
Target Start/End: Complemental strand, 18948299 - 18948211
Alignment:
| Q |
134 |
gtggtcgtagtctcggacaatgctcgccctgcagaagcattgatatttggtcgctggaccctctgcagcagcttttcagccattatttt |
222 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18948299 |
gtggttgtagtctcggacagtgctcgccctgcagaagcattgatatttggtcactggaccctctgcagcagcttttcagccattatttt |
18948211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University