View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4542_low_15 (Length: 259)
Name: NF4542_low_15
Description: NF4542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4542_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 42158599 - 42158841
Alignment:
| Q |
1 |
acagcccttaaa-ctctttctcaagtcccctcagttttttcaaggtgcgagaatcgtttgtagcattctcgaacatgagaatctcaagagaatcaagcca |
99 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42158599 |
acagcccttaaaactttttctcaagtcccctcagttttttcaaggtgcaagaatcgtttgtagcattctcgaacatgagaatcttaagagaatcaagcca |
42158698 |
T |
|
| Q |
100 |
aggtccacgaaaacgaaatgtatggtgaagatcttcaagtaacttaacgagtagagagcgttgattgtcaaggagatctaagattgaatggtttttgaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42158699 |
aggtccacgaaaacgaaatgtatggtgaagatcttcaagtaacttaacgagtagaaagcgttgattgtcaaggagatctaagattgaatggttcttgaga |
42158798 |
T |
|
| Q |
200 |
agaagtaaaagttccgccaaggttgtgtatgccaagcccttca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42158799 |
agaagtaaaagttccgccaaggttgtgtatgccaagcccttca |
42158841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University