View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4542_low_16 (Length: 258)
Name: NF4542_low_16
Description: NF4542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4542_low_16 |
 | |
|
| [»] scaffold2089 (2 HSPs) |
| | |
|
| [»] scaffold0445 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold2089 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: scaffold2089
Description:
Target: scaffold2089; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 644 - 753
Alignment:
| Q |
1 |
tcatctcattcattttcttaccaaaccaaacttcatcattaacatcttgttgttgtgcttcctctaagtctatccatattatatatgctctctcagttga |
100 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
644 |
tcatctcatttattttcttaccaa-ccaaactttatcattactatctcgttgttgtgcttcctctaagtctatccatattatatatgctcagtcagttga |
742 |
T |
|
| Q |
101 |
taccttcattt |
111 |
Q |
| |
|
|||||| |||| |
|
|
| T |
743 |
taccttgattt |
753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2089; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 108 - 159
Target Start/End: Original strand, 765 - 815
Alignment:
| Q |
108 |
atttcatcattgatatcttgcattgcttcctcttaagtctatctttggcaga |
159 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| |||||| |||| |
|
|
| T |
765 |
atttcatcattgatatcttggattgcttcctc-taagtctttctttgccaga |
815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 54 - 102
Target Start/End: Complemental strand, 9076 - 9028
Alignment:
| Q |
54 |
tgtgcttcctctaagtctatccatattatatatgctctctcagttgata |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
9076 |
tgtgcttcctctaagtctatccatattatatatggtcagtcagttgata |
9028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University