View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4542_low_19 (Length: 237)

Name: NF4542_low_19
Description: NF4542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4542_low_19
NF4542_low_19
[»] chr5 (1 HSPs)
chr5 (134-222)||(18948211-18948299)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 134 - 222
Target Start/End: Complemental strand, 18948299 - 18948211
Alignment:
134 gtggtcgtagtctcggacaatgctcgccctgcagaagcattgatatttggtcgctggaccctctgcagcagcttttcagccattatttt 222  Q
    ||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
18948299 gtggttgtagtctcggacagtgctcgccctgcagaagcattgatatttggtcactggaccctctgcagcagcttttcagccattatttt 18948211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University