View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4542_low_22 (Length: 223)
Name: NF4542_low_22
Description: NF4542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4542_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 214
Target Start/End: Complemental strand, 36126165 - 36125956
Alignment:
| Q |
5 |
tcaacatctcaccttcttcgcctctactcccaccacctatgcttttatccaacacttctccactccacccttccctcactatagattccacccacattgc |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36126165 |
tcaacatctcaccttcttcacctctactcccaccacctatgcttttatccaacacttctccactccacccatccctcactatagattccacccacattgc |
36126066 |
T |
|
| Q |
105 |
taaatcttcatttgctcccttcccatgcctcaaataatttgcagggaacttccctgtcaatagctccaatataagtatccctaaacaccatacgtcgttc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36126065 |
taaatcttcatttgctcccttcccatgcctcaaataatttgcagggaacttccctgtcaatagctccaatataagtatccctaaacaccatacgtcgctc |
36125966 |
T |
|
| Q |
205 |
ttctcactcg |
214 |
Q |
| |
|
||||| |||| |
|
|
| T |
36125965 |
ttctcgctcg |
36125956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University