View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4543_low_19 (Length: 279)

Name: NF4543_low_19
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4543_low_19
NF4543_low_19
[»] chr3 (1 HSPs)
chr3 (1-260)||(27189664-27189923)


Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 27189923 - 27189664
Alignment:
1 ggctactgcgccagcaataacaacggcggatgtagcgagacggagtggtggcgatagtttgtcaacgacgttttcgattccggtgaggtctttgggcgga 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||    
27189923 ggctactgcgccggcaataacaacggcggatgtagcgagacggagtggtggtgatagtttgtcgacgacgttttcgattccggtgaggtctttgggcgga 27189824  T
101 ggaacggaggaggatgatgaagagcgtgggagtgagagtttgaaacagtgtcgtttggtggatgaagagagtgggaaagggaagggtaatggaatgagag 200  Q
    |||||||||||||| ||||| ||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||    
27189823 ggaacggaggaggaggatgatgagcgagggagtgggagtttgaaacggtgtcgtttggtggatgaagagagtgggaaagggaagggtgatggaatgagag 27189724  T
201 aagaaggtgtgagagttgacgaaggattcattgttttggtttgatttgaaatgagaaaag 260  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27189723 aagaaggtgtgagagttgacgaaggattcattgttttggtttgatttgaaatgagaaaag 27189664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University