View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4544-Insertion-10 (Length: 209)
Name: NF4544-Insertion-10
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4544-Insertion-10 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 119 - 209
Target Start/End: Original strand, 35406185 - 35406275
Alignment:
| Q |
119 |
gtgttggtgttttagcatggtaatgcacatgaaaatcacatttttctagcttattcttgtctttctttccttgcattgaaagatatggata |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35406185 |
gtgttggtgttttagcatggtaatgcacatgaaaatcacatttttctagtttattcttgtctttctttccttgcattgaaagatatggata |
35406275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 7 - 86
Target Start/End: Original strand, 35406073 - 35406152
Alignment:
| Q |
7 |
acaccttaattaattcatctcaccaacctttcccttctttatcattaatactattaccacagaagccttggaacaagtca |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35406073 |
acaccttaattaattcatctcaccaacctttcccttctttatcattaatactattaccacagaagccttggaacaagtca |
35406152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University