View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4544-Insertion-11 (Length: 276)
Name: NF4544-Insertion-11
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4544-Insertion-11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 8 - 276
Target Start/End: Complemental strand, 34012736 - 34012456
Alignment:
| Q |
8 |
tgatgaacttgaattgatagtgttgattgtcaaaaattagacagaagctatgttgatgtggatgatagaatgggaattgggaagatataattgataaaat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012736 |
tgatgaacttgaattgatagtgttgattgtcaaaaattagatagaagctatgttgatg------atagaatgggaattgggaagatataattgataaaat |
34012643 |
T |
 |
| Q |
108 |
tggtaa------------------gcaattagacatagtcaagacttactttaagaagaagtaatgatatattggttggggaaaatatagttacaatatt |
189 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34012642 |
tggtaatagttcagtaaatagttagcaattagacatggtcaagacttactttaagaagaagtaatgatatattggttggggaaaatatagttataatatt |
34012543 |
T |
 |
| Q |
190 |
gaaaatatcaaagtctctttacaaatattagatgtttatgtagagtgcannnnnnncctccgcttcatatctttattttttaagaat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34012542 |
gaaaatatcaaagtctctttacaaatattagatgtttatgtagagtgcatttttttcctccgcttcatatctttattttttaagaat |
34012456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University