View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4544-Insertion-12 (Length: 229)
Name: NF4544-Insertion-12
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4544-Insertion-12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 85 - 229
Target Start/End: Original strand, 43653302 - 43653446
Alignment:
| Q |
85 |
tagtgaaacaaaagatgtttaaggttagagtcagaccttctgtttagcaagatcttggcaaccagtgaaattctcagggaacttgcaagtaccaaattgc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43653302 |
tagtgaaacaaaagatgtttaaggttagagtcagaccttctgtttagcaagatcttggcaaccggtgaaattctcagggaacttgcaagtaccaaattgc |
43653401 |
T |
 |
| Q |
185 |
actgtatatgctcttgcaaaatttgctccactagtggctaacctc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43653402 |
actgtatatgctcttgcaaaatttgctccactagtggctaacctc |
43653446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University