View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4544-Insertion-14 (Length: 230)
Name: NF4544-Insertion-14
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4544-Insertion-14 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 230
Target Start/End: Complemental strand, 32789761 - 32789539
Alignment:
| Q |
8 |
gatatgatggtaacccttttggaaatggcataagaggaagttgacaaaattgctttggaagatgaagccttaatctatcataagttttgagttgccacat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789761 |
gatatgatggtaacccttttggaaatggcataagaggaagttgacaaaattgctttggaagatgaagccttaatctatcataagttttgagttgccacat |
32789662 |
T |
|
| Q |
108 |
tggagctaaacaattagctctttcaaggatttgacttggaattcctttttgtttaagacatgctgctgctgctaatcctgagggaccagctccaactata |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789661 |
tgaagctaaacaattagctctttcaaggatttgacttggaattcctttttgtttaagacatgctgctgctgctaatcctgagggaccagctccaactata |
32789562 |
T |
|
| Q |
208 |
attggtccatgaaccaatcttga |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32789561 |
attggtccatgaaccaatcttga |
32789539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 182
Target Start/End: Complemental strand, 50667509 - 50667382
Alignment:
| Q |
55 |
aattgctttggaagatgaagccttaatctatcataagttttgagttgccacattggagctaaacaattagctctttcaaggatttgacttggaattcctt |
154 |
Q |
| |
|
||||| |||||||||||||| | |||| ||| || |||||||||||||| | || ||| | |||||||| |||||| || ||| || |||||| || |
|
|
| T |
50667509 |
aattgttttggaagatgaagacgcaatcgatcgtaggttttgagttgccataatgaagccacacaattagatctttctagtattacacatggaatgtttt |
50667410 |
T |
|
| Q |
155 |
tttgtttaagacatgctgctgctgctaa |
182 |
Q |
| |
|
|||||| |||||||| ||||||||||| |
|
|
| T |
50667409 |
tttgttgtagacatgcagctgctgctaa |
50667382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University