View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4544-Insertion-15 (Length: 200)
Name: NF4544-Insertion-15
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4544-Insertion-15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 8 - 200
Target Start/End: Original strand, 30104720 - 30104912
Alignment:
| Q |
8 |
aagagtgtgtgataatgatcatgattaggaggcatatgaagcaaagaatgacgaagttgaaacacagctgattcctcttgttcatctctaacatcttcaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30104720 |
aagagtgtgtgataatgatcatgattaggaggcatatgaagcaaagaatgacgaagttgaaacacagctgattcctcctgttcatctctaacatcttcaa |
30104819 |
T |
 |
| Q |
108 |
ttggaaacctataatcaattttactcttccctcttgttttcttgagagaatgagtgaatctacatgaagcatttattgctttctttttcagcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30104820 |
ttggaaacctataatcaattttactcttccctcttgttttcttgagagaatgagtgaatctacatgaagcatttattgctttctttttcagcc |
30104912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University