View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4544-Insertion-16 (Length: 155)
Name: NF4544-Insertion-16
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4544-Insertion-16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 6e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 6e-60
Query Start/End: Original strand, 22 - 155
Target Start/End: Complemental strand, 40667759 - 40667630
Alignment:
| Q |
22 |
atttttatgcatattcatatatttcacaacttgatcatgtgacctgtctgtctctttgtggaatatgctatttaaggatccctcgtctctgctttaacgc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40667759 |
atttttatgcatattcatatatttcacaacttgatcatgtgacctgtct----ctttgtggaatatgctatttaaggatccctcgtctctgctttaacgc |
40667664 |
T |
|
| Q |
122 |
tgggacccgattgtgctgcttttcttttacgtga |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40667663 |
tgggacccgattgtgctgcttttcttttacgtga |
40667630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University