View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4544R-Insertion-8 (Length: 68)
Name: NF4544R-Insertion-8
Description: NF4544R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4544R-Insertion-8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 9e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 9e-20
Query Start/End: Original strand, 8 - 64
Target Start/End: Original strand, 31826869 - 31826925
Alignment:
| Q |
8 |
aaaaagtttttctcaacaatgataaatgaagtgatgaaaatctctaaattttataca |
64 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31826869 |
aaaaagttcttctcaacaacgataaatgaagtgatgaaaatctctaaattttataca |
31826925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University