View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4544_high_17 (Length: 229)

Name: NF4544_high_17
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4544_high_17
NF4544_high_17
[»] chr4 (1 HSPs)
chr4 (1-118)||(34013307-34013424)


Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 34013424 - 34013307
Alignment:
1 ctagaaggacgaatattggtcgaactttacaacgatgttgttcccaaaactgctgaaaatttcagagctctatgtactggtgagaaaggcagtggtccca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34013424 ctagaaggacgaatattggtcgaactttacaacgatgttgttcccaaaactgctgaaaatttcagagctctatgtactggtgagaaaggcagtggtccca 34013325  T
101 atactggggtacccctcc 118  Q
    ||||||||||||||||||    
34013324 atactggggtacccctcc 34013307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University