View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4544_low_18 (Length: 238)

Name: NF4544_low_18
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4544_low_18
NF4544_low_18
[»] chr5 (2 HSPs)
chr5 (1-88)||(11317869-11317957)
chr5 (163-222)||(11317736-11317795)
[»] chr1 (1 HSPs)
chr1 (3-72)||(12305353-12305422)


Alignment Details
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 11317957 - 11317869
Alignment:
Q  1 tattgtagtgaattgattcacaacttttctcgatcaattaacaaagaaaagcattttagaaatatatc-aaaccaatgatgaatgtgtg 88  Q
    |||||||||||||||||||||||||||| || |||||||||||||||||||||||||  |||| |||| ||||||||| ||||||||||    
T  11317957 tattgtagtgaattgattcacaacttttttcaatcaattaacaaagaaaagcatttttaaaatctatcaaaaccaatggtgaatgtgtg 11317869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 163 - 222
Target Start/End: Complemental strand, 11317795 - 11317736
Alignment:
Q  163 acacataattgattttctctcttttgcataagttaaatatgattcttggagatctgtatt 222  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||  |||||||    
T  11317795 acacatgattgattttctctcttttgcataagttaaatatgattcttggagtcctgtatt 11317736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 72
Target Start/End: Complemental strand, 12305422 - 12305353
Alignment:
Q  3 ttgtagtgaattgattcacaacttttctcgatcaattaacaaagaaaagcattttagaaatatatcaaac 72  Q
    |||| ||||||||||||||||||| | |  ||||||||||||| | || ||||||| |||| ||||||||    
T  12305422 ttgttgtgaattgattcacaacttgtttgaatcaattaacaaatagaatcattttataaatctatcaaac 12305353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University