View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4544_low_18 (Length: 238)
Name: NF4544_low_18
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4544_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 11317957 - 11317869
Alignment:
| Q |
1 |
tattgtagtgaattgattcacaacttttctcgatcaattaacaaagaaaagcattttagaaatatatc-aaaccaatgatgaatgtgtg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |||| |||| ||||||||| |||||||||| |
|
|
| T |
11317957 |
tattgtagtgaattgattcacaacttttttcaatcaattaacaaagaaaagcatttttaaaatctatcaaaaccaatggtgaatgtgtg |
11317869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 163 - 222
Target Start/End: Complemental strand, 11317795 - 11317736
Alignment:
| Q |
163 |
acacataattgattttctctcttttgcataagttaaatatgattcttggagatctgtatt |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11317795 |
acacatgattgattttctctcttttgcataagttaaatatgattcttggagtcctgtatt |
11317736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 72
Target Start/End: Complemental strand, 12305422 - 12305353
Alignment:
| Q |
3 |
ttgtagtgaattgattcacaacttttctcgatcaattaacaaagaaaagcattttagaaatatatcaaac |
72 |
Q |
| |
|
|||| ||||||||||||||||||| | | ||||||||||||| | || ||||||| |||| |||||||| |
|
|
| T |
12305422 |
ttgttgtgaattgattcacaacttgtttgaatcaattaacaaatagaatcattttataaatctatcaaac |
12305353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University