View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4544_low_21 (Length: 212)
Name: NF4544_low_21
Description: NF4544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4544_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 13140038 - 13140222
Alignment:
| Q |
10 |
gagcagagatgagaagcagaaaaaccatcaaaaaacaacgattgttcgtgaaggtttccacagaaagaccccttggttctggcaaacagatcacaattac |
109 |
Q |
| |
|
|||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13140038 |
gagcagcggtgagaagcggaaaaaccatcaaaaaacaacgattgttcgtgaaggtttccacagaaagaccccttggttctggcaaacagatcacaattac |
13140137 |
T |
|
| Q |
110 |
agtcatggccaaaacactcattcccatgatttctttcgaaaattgccttgagtcataagcacatatctttgctacaccatgcatg |
194 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
13140138 |
aatcatggccaaaacactcattcccatgatttctttcgaaaaatgccttgagtcataagcacatctatttgctacaccatgcatg |
13140222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University