View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4545-Insertion-11 (Length: 116)

Name: NF4545-Insertion-11
Description: NF4545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4545-Insertion-11
NF4545-Insertion-11
[»] chr8 (1 HSPs)
chr8 (8-116)||(39264220-39264328)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 39264328 - 39264220
Alignment:
8 agaaatccatcccagttccagtcttattgatgatatcttcatcaattactttagattgttgaaagagctgttgcaaagtgaacttaccacttttatcgtc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39264328 agaaatccatcccagttccagtcttattgatgatatcttcatcaattactttagattgttgaaagagctgttgcaaagtgaacttaccacttttatcgtc 39264229  T
108 accttgttg 116  Q
    |||||||||    
39264228 accttgttg 39264220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University