View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4545_high_3 (Length: 339)
Name: NF4545_high_3
Description: NF4545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4545_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 22 - 153
Target Start/End: Original strand, 3145848 - 3145978
Alignment:
| Q |
22 |
atgcgcaataatcaatcatgataaacttgtaagaaccataatactgtcacaaagttgtctggtttgggggattcttgatggtttcatgattatttttatc |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3145848 |
atgcccaataatcaatcatgataaacttgtaaaaaccataatactgtcacaaagttgtctggtttgggggattcttgatggtttcatgatta-ttttatc |
3145946 |
T |
 |
| Q |
122 |
atattttccctttcatgactttttatcgagtt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3145947 |
atattttccctttcatgactttttatcgagtt |
3145978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 220 - 331
Target Start/End: Original strand, 3146046 - 3146157
Alignment:
| Q |
220 |
gaagttgtcaagatgtatgctagtggattaaaattccatataagaaagaaagaatggaaaattctttaaaaataaagaattagttatctgacgcgtaata |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3146046 |
gaagttgtcaagatgtatgctagtggattaaaattccatataagaaagaaagaatggaaaattctttaaaaataaagaattagttatctgacgcgtaata |
3146145 |
T |
 |
| Q |
320 |
tttgtgatgatg |
331 |
Q |
| |
|
||| |||||||| |
|
|
| T |
3146146 |
tttatgatgatg |
3146157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 82
Target Start/End: Original strand, 36644757 - 36644812
Alignment:
| Q |
27 |
caataatcaatcatgataaacttgtaagaaccataatactgtcacaaagttgtctg |
82 |
Q |
| |
|
||||||||||||||||||||||||||| || |||| || |||||||||||||||| |
|
|
| T |
36644757 |
caataatcaatcatgataaacttgtaaaaagcatagcacagtcacaaagttgtctg |
36644812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University