View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4546-Insertion-4 (Length: 203)
Name: NF4546-Insertion-4
Description: NF4546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4546-Insertion-4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 8 - 187
Target Start/End: Original strand, 20065809 - 20065988
Alignment:
| Q |
8 |
acccgttctatatctcttcgctcaacattatttggtattctgatgttaaatgtttccacaatgaagttggcatgttcttgattgacaacttccttaatcn |
107 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20065809 |
accctttctatatctcttcgctctacattatttggtattctgatgttaaatgtttccacaatgaagttggcatgttcttgattgacaacttccttaatct |
20065908 |
T |
|
| Q |
108 |
nnnnnnnnnnnnattcttcctcgtattcatgttccttcatagtttcaatttttggggggagatgcggatatggtagcact |
187 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20065909 |
tttttgttttttattcttcctcatattcatgttccttcatagtttcaatttttggggggagatgcgaatatggtagcact |
20065988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University