View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4546_high_21 (Length: 220)
Name: NF4546_high_21
Description: NF4546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4546_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 20082193 - 20082135
Alignment:
| Q |
1 |
ataaaagcaaggatagatgaaagaacacgaatcaatgaaaatttgtgaatcaagaatca |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
20082193 |
ataaaagcaaggatagatgaaagaacacgaataaatgagaattcatgaatcaagaatca |
20082135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 20069384 - 20069341
Alignment:
| Q |
161 |
caatttaagaggattaactctaggctgattgggttccaattatc |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20069384 |
caatttaagaggattaactctacgctgattgggttccaattatc |
20069341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University