View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4546_low_13 (Length: 331)
Name: NF4546_low_13
Description: NF4546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4546_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 295
Target Start/End: Original strand, 28978150 - 28978436
Alignment:
| Q |
14 |
gagatgaaagtgctgccaagatggttgatgttgtttcttccatatggataaatgaattggtttggagtgttagtttt-ttacttatagaattcgagagta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28978150 |
gagatgaaagtgctgccaagatggttgatgttgtttcttccatatggataaatgaattggtttggagtgttagtttttttacttatagaattcgagagta |
28978249 |
T |
 |
| Q |
113 |
atttgggagtgtgaatggggatgatgatgagaaggcttttgctttttatgtatgttgtgtaccacatgtgttttactcattactgtcatcatcactgcta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28978250 |
atttgggagtgtgaatggggatgatgatgagaaggcttttgctttttatgtatgtagtgtaccacatgtgttttactcattactgtcatcatcactgcta |
28978349 |
T |
 |
| Q |
213 |
cctcctttttgaatgatccaatgtgtcattgatctctcatcc-tttca---taattctactaactactttaacacagaaaaaagaaa |
295 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28978350 |
cttcctttttgtatgatccaatgtgtcattgatctctgttccttttcattgtaattctactaactactttaagacagaaaaaagaaa |
28978436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University