View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4546_low_22 (Length: 248)
Name: NF4546_low_22
Description: NF4546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4546_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 1284401 - 1284633
Alignment:
| Q |
1 |
aaaagagtttaccttgcaatagaatttcaatgtgatattaggtaataggtgtcagtgatgaagtttttaacttttgatgccacaaattcatgaggctgat |
100 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1284401 |
aaaagagtttaacttacaatagaatctcaatgtgctattaggtaatatgtgtcagtgatgaagtttttaacttttgatgccacaaattcatgaggctgat |
1284500 |
T |
 |
| Q |
101 |
agtgggttagtgaggttaacaaacaatatggggaggctgcatgggaaaattctaccatatgcccactataacaaatccagccatcatattacattaatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1284501 |
agtgggttagtgaggttaacaaacaatatggggaggctgcatgggaaaattctaccatatgcccactatgacaaatccagccatcatattacattaatta |
1284600 |
T |
 |
| Q |
201 |
tatactaata-taataatttgcaatgagcaata |
232 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1284601 |
tatactaatattaataatttgcaatgagcaata |
1284633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University