View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4547-Insertion-8 (Length: 117)

Name: NF4547-Insertion-8
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4547-Insertion-8
NF4547-Insertion-8
[»] chr2 (2 HSPs)
chr2 (8-116)||(27173180-27173288)
chr2 (14-54)||(29669120-29669160)
[»] chr6 (1 HSPs)
chr6 (10-54)||(10258489-10258533)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 5e-38; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 27173288 - 27173180
Alignment:
8 gaaggttgaatcctttgatgtgtttaaatgcagtttcctaagtttttcttctattgctgcgtttgcagtgannnnnnngtataacatactttgactcttt 107  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       || |||||||||||||||||||    
27173288 gaagattgaatcctttgatgtgtttaaatgcagtttcctaagtttttcttctattgctgcgtttgcagtgatttttttgtgtaacatactttgactcttt 27173189  T
108 gtttctcca 116  Q
    |||||||||    
27173188 gtttctcca 27173180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 29669160 - 29669120
Alignment:
14 tgaatcctttgatgtgtttaaatgcagtttcctaagttttt 54  Q
    ||||||||||||||||||||||||||||||  |||||||||    
29669160 tgaatcctttgatgtgtttaaatgcagttttttaagttttt 29669120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 10258533 - 10258489
Alignment:
10 aggttgaatcctttgatgtgtttaaatgcagtttcctaagttttt 54  Q
    |||||||||| |||||| |||||||| ||| ||||||||||||||    
10258533 aggttgaatcatttgatatgtttaaaggcaatttcctaagttttt 10258489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University