View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547_low_12 (Length: 248)
Name: NF4547_low_12
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4547_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 134 - 241
Target Start/End: Complemental strand, 45762452 - 45762345
Alignment:
| Q |
134 |
ttgatttgaatctcttacgttaaggaagaaggaccaagcaatggattctccctaaaaggctgaaaagagaacctgtgaagaaacctagcaacacaatgat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45762452 |
ttgatttgaatctcttacgttaaggaagaaggaccaagcaatggattctccctaaaaggctgaaaagagaacctgtgaagaaacctagcaacacaatgat |
45762353 |
T |
 |
| Q |
234 |
gatgatgt |
241 |
Q |
| |
|
|||||||| |
|
|
| T |
45762352 |
gatgatgt |
45762345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 25 - 61
Target Start/End: Complemental strand, 45762565 - 45762529
Alignment:
| Q |
25 |
gtttgatcatcaataatagcaatgccaaaatcaactt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45762565 |
gtttgatcatcaataatagcaatgccaaaatcaactt |
45762529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 39279342 - 39279296
Alignment:
| Q |
158 |
gaagaaggaccaagcaatggattctccctaaaaggctgaaaagagaa |
204 |
Q |
| |
|
||||||||||||||||| |||||||| | ||||||||||||||||| |
|
|
| T |
39279342 |
gaagaaggaccaagcaaaggattctctttcaaaggctgaaaagagaa |
39279296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University