View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4547_low_7 (Length: 301)

Name: NF4547_low_7
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4547_low_7
NF4547_low_7
[»] chr4 (3 HSPs)
chr4 (202-287)||(4695840-4695925)
chr4 (1-35)||(4695148-4695182)
chr4 (98-135)||(4695725-4695763)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 202 - 287
Target Start/End: Original strand, 4695840 - 4695925
Alignment:
202 catgatatatttgccaccatgagaaattttgctttcgttcgattgagtatgcttgatatgaacgtattattaggcttattgttgat 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||    
4695840 catgatatatttgccaccatgagaaattttgctttcgttcgattgagtatgcttgatatgaacgtattgttaggcttaatgttgat 4695925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 4695148 - 4695182
Alignment:
1 cttatttcgttcgatatctattttccttgttaatc 35  Q
    ||||||||||||||||||||||| |||||||||||    
4695148 cttatttcgttcgatatctatttgccttgttaatc 4695182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 135
Target Start/End: Original strand, 4695725 - 4695763
Alignment:
98 tgtatttgattctgttgttaaataa-ttagtgattattt 135  Q
    ||||||||||||||||||||||||| |||||||||||||    
4695725 tgtatttgattctgttgttaaataatttagtgattattt 4695763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University