View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4549_high_6 (Length: 229)
Name: NF4549_high_6
Description: NF4549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4549_high_6 |
 | |
|
| [»] scaffold0110 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0110 (Bit Score: 180; Significance: 2e-97; HSPs: 3)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 23 - 218
Target Start/End: Original strand, 30202 - 30397
Alignment:
| Q |
23 |
aagtatgtgtttggattagcagtgagtttgtcagagtcatgatgtgccatagtgatttcggcaaaaactacactttgccgcttcaacaaagtcacatggt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30202 |
aagtatgtgtttggattagcagtgagtttgtcagagtcatgatgtgccatagtgatttaggcaaaaactacactttgcagcttcaacaaagtcacatggt |
30301 |
T |
|
| Q |
123 |
gcaactgtgatttcatcaaacttgatgtgattcttattatgcactaagtggtttatttaatttgttcttctgatgtttttatcttgtggtgatgat |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30302 |
gcaactgtgatttcgtcaaacttgatgtgattcttattatgcactaagtggtttattcaatttgttcttctgatgtttttatcttgtggtgatgat |
30397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 45 - 170
Target Start/End: Original strand, 13398 - 13523
Alignment:
| Q |
45 |
tgagtttgtcagagtcatgatgtgccatagtgatttcggcaaaaactacactttgccgcttcaacaaagtcacatggtgcaactgtgatttcatcaaact |
144 |
Q |
| |
|
||||||||||| | ||| |||||||||||||||||||| ||||||||||| |||| ||||||||||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
13398 |
tgagtttgtcacaatcacgatgtgccatagtgatttcgccaaaaactacattttgaagcttcaacaaaatcacaaggtgcaactgtgatttcgtcaaact |
13497 |
T |
|
| Q |
145 |
tgatgtgattcttattatgcactaag |
170 |
Q |
| |
|
||| ||||| | || |||||||||| |
|
|
| T |
13498 |
cgatttgattttcatcatgcactaag |
13523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 45 - 170
Target Start/End: Original strand, 21135 - 21260
Alignment:
| Q |
45 |
tgagtttgtcagagtcatgatgtgccatagtgatttcggcaaaaactacactttgccgcttcaacaaagtcacatggtgcaactgtgatttcatcaaact |
144 |
Q |
| |
|
||||||||||| | ||| |||||||||||||||||||| ||||||||||| |||| ||||||||||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
21135 |
tgagtttgtcacaatcacgatgtgccatagtgatttcgccaaaaactacattttgaagcttcaacaaaatcacaaggtgcaactgtgatttcgtcaaact |
21234 |
T |
|
| Q |
145 |
tgatgtgattcttattatgcactaag |
170 |
Q |
| |
|
||| ||||| | || |||||||||| |
|
|
| T |
21235 |
cgatttgattttcatcatgcactaag |
21260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University