View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4549_low_3 (Length: 321)
Name: NF4549_low_3
Description: NF4549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4549_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 19 - 144
Target Start/End: Original strand, 9283154 - 9283279
Alignment:
| Q |
19 |
ctaaaatctaagtttccttatctataatagttatcgaactacagttagaaccttgcgaagtcatattgtcctggctgttcatttgtctaaacttatgcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9283154 |
ctaaaatctaagtttccttatctagaatagttatcgaactacaattagaaccttgcgaagtcatattgtcctggctaatcatttgtctaaacttatgcaa |
9283253 |
T |
 |
| Q |
119 |
attgttacaagtttaatcttttttgt |
144 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
9283254 |
attgttacaagtttaatcttttttgt |
9283279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 184 - 321
Target Start/End: Original strand, 9283261 - 9283407
Alignment:
| Q |
184 |
caagtttaatcttttttgttaaaagaacacaacctactaaaaataaaaatactcttacatacaccaaaactcaaggtcactcacaccatac--------- |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
9283261 |
caagtttaatcttttttgttaaaagaacacaacctactaaaaata------ctcttacatacaccaaaactcaaggccactgacaccatacctgctaaaa |
9283354 |
T |
 |
| Q |
275 |
------aaacatgcatgaaacagaagctaagctgactagcagatcacaaaatc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9283355 |
ccactgaaacatgcatgaaacagaagctaagctgactagcagatcacaaaatc |
9283407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University