View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4549_low_5 (Length: 298)
Name: NF4549_low_5
Description: NF4549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4549_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 288
Target Start/End: Original strand, 28238686 - 28238956
Alignment:
| Q |
18 |
ctaacaatggtttatacttcctttgcattttttatgaaactgagtgcaggacacacaatgaacattatgtccacccaccagtgtggttggcccctaagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28238686 |
ctaacaatggtttatacttcctttgcattttttatgaaactgagtgcaggacacacaatgaacattatgtccacccaccagtgtggttggcccctaagaa |
28238785 |
T |
 |
| Q |
118 |
tccaggatcatcctgacaaaggaagtattaataaggctcaattttcaggatatcattctccctccaaaggattggacttccttaatgttgctcaacataa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28238786 |
tccaggatcatcctgacaaaggaagtattaataaggctcaattttcaggatatcattctccctccaaaggattagacttccttaatgttgctcaacataa |
28238885 |
T |
 |
| Q |
218 |
atgttgcaatactgccagaaaatgtaggcctatttttgccagtacagcgagtgacaatatggatccctatg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28238886 |
atgttgcaatactgccagaaaatgtaggcctatttttgccagtacagcgagtgacaatatggatccctatg |
28238956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University