View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4549_low_8 (Length: 252)
Name: NF4549_low_8
Description: NF4549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4549_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 37319106 - 37318887
Alignment:
| Q |
19 |
caacatccatgttactgtcgatgatggtgtccataaagaatataaacgatgttacctcgttacctgcataataaagcaactcatttagccctcaaattta |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37319106 |
caacatccacgttactgtcgatgatggtgtccataaagaatataaacgatgttacctcgttacctgcataataaagcaactcatttagccctcaaattta |
37319007 |
T |
|
| Q |
119 |
gttctcatagtattaattttaggcgttacttttgtgactaattgattctataaaaattaatcaaagatgtaaatctatttgatacctacctattcttaac |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37319006 |
gttctcatagtattaattttacgcgttacttttgtgactaattgattctataaaaattaatcaaagatgtaaatctatttgata----cctattcttaac |
37318911 |
T |
|
| Q |
219 |
aagtctttatttttgtgatgatgt |
242 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
37318910 |
aagtctttatttttgtgattatgt |
37318887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 34 - 82
Target Start/End: Complemental strand, 37244882 - 37244834
Alignment:
| Q |
34 |
tgtcgatgatggtgtccataaagaatataaacgatgttacctcgttacc |
82 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
37244882 |
tgtcgatgatggtgtccataaaacatataaaagatgttacctcgttacc |
37244834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University