View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4550_high_11 (Length: 215)
Name: NF4550_high_11
Description: NF4550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4550_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 197
Target Start/End: Complemental strand, 48202872 - 48202689
Alignment:
| Q |
14 |
cagagaacaatgagtttatgataaaggagttacctcttccacctgcaatgttgcatcctaaggaatcattttcttcaaataatatgaaaagggtaacttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48202872 |
cagagaacaatgagtttatgataaaggagttacctcttccacctgcaatgttgcatcctaaggaatcattttcttcaaataatatgaaaagggtaacttc |
48202773 |
T |
|
| Q |
114 |
tgaacgaaggacttcttatagtttaagcattaaaatgccaactttgccaaggaatttgtcaattgcgaaaaactgggatcatct |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48202772 |
tgaacgaaggacttcttttagtttaagcattaaaatgccaactttgccaaggaatttgtcaattgcgaaaaattgggatcatct |
48202689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University