View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4550_low_10 (Length: 297)
Name: NF4550_low_10
Description: NF4550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4550_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 78 - 217
Target Start/End: Original strand, 26377128 - 26377267
Alignment:
| Q |
78 |
gaccttggaagcattgagtttgacccgtgtccaacgagacgcagcagtttcaggcaaattaaagaacgaaattgtgctatgattcaacctaacaaaatct |
177 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26377128 |
gaccttggaagcgttgagtttgacccgtgtccaacgagacgcagcagtttcaggcaaattaaagaacgaaattgtgctatgattcaacctaacaaaatct |
26377227 |
T |
|
| Q |
178 |
atcgcttgccacctgaacaacaattcaacatttatttctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26377228 |
atcgcttgccacctgaacaacaattcaacatttatttctc |
26377267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University