View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4550_low_6 (Length: 422)
Name: NF4550_low_6
Description: NF4550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4550_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 204 - 408
Target Start/End: Original strand, 7357130 - 7357334
Alignment:
| Q |
204 |
gcgattattgataatagtcataagaaaagcgcgttgaagagagattttgatgggtctttgatactaccaatgggtggtcatggtggtgatgtgattcttt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7357130 |
gcgattattgataatagtcataagaaaagcgcgttgaagagagattttgatgggtctttgatactaccaatgggtggtcatggtggtgatgtgattcttt |
7357229 |
T |
 |
| Q |
304 |
atgctgatgaaggaaaagatacattgttggagtttcatagtaagagtcggtttaatgcgaaacgtggtgggaatgttgatgctgttggtgtttttacttc |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7357230 |
atgctgatgaaggaaaagatacattgttggagtttcatagtaagagtcggtttaatgcgaaacgtggtgggaatgttgatgctgttggtgtttttacttc |
7357329 |
T |
 |
| Q |
404 |
ttact |
408 |
Q |
| |
|
||||| |
|
|
| T |
7357330 |
ttact |
7357334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 7356927 - 7357077
Alignment:
| Q |
1 |
aacacagacgaaaaacaatacaatgcagaattcaaaccttaaaccctacgcaaccaccaccctcaccagccttaaccaaagaacctcacaaattcttcga |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7356927 |
aacacaaacgaaaaacaatacaatgcagaattcaaaccttaaaccctacgcaaccaccaccctcaccagccttaaccaaagaacctcacaaattcttcga |
7357026 |
T |
 |
| Q |
101 |
ccaagtaatcatcaccgttcgtggaggagacggtggtcacggagcaatact |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7357027 |
ccaagtaatcatcaccgttcgtggaggagacggtggtcacggagcaatact |
7357077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University