View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4551-Insertion-7 (Length: 108)
Name: NF4551-Insertion-7
Description: NF4551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4551-Insertion-7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 1e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 13 - 90
Target Start/End: Complemental strand, 28922446 - 28922370
Alignment:
| Q |
13 |
ttcaatataatatatccttttaatattttattatgttcaagaggatcactttcacttatttataatctaattgtgata |
90 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28922446 |
ttcaatataatatatccttt-aatattttattatgctcaagaggatcactttcacttatttataatctaattgtgata |
28922370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 28912988 - 28912924
Alignment:
| Q |
11 |
agttcaatataatatatccttttaatattttattatgttcaagaggatcactttcacttatttat |
75 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28912988 |
agttcaatataatatatcctttaatgtttttattattttcaagaggatcactttcacttatttat |
28912924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University