View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4551-Insertion-8 (Length: 92)
Name: NF4551-Insertion-8
Description: NF4551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4551-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 9 - 92
Target Start/End: Original strand, 52344124 - 52344207
Alignment:
| Q |
9 |
gtattgggacacatatcctccaattgagatttgatgtcatctattaactcaaaacctcttagcgaatttgcatttggaaatgcg |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52344124 |
gtattgggacacatatcctccaattgagatttgatgtcatctattaactcaaaacctcttagcgaatttgcatttggaaatgcg |
52344207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 9155556 - 9155609
Alignment:
| Q |
26 |
ctccaattgagatttgatgtcatctattaactcaaaacctcttagcgaatttgc |
79 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||||||||||||||| ||||| |
|
|
| T |
9155556 |
ctccaatgtagatttgatgtcgtcaattaactcaaaacctcttagcgagtttgc |
9155609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University