View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4551_high_4 (Length: 329)
Name: NF4551_high_4
Description: NF4551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4551_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 21 - 309
Target Start/End: Complemental strand, 3973287 - 3972999
Alignment:
| Q |
21 |
tcactcgtggcggaaacggcgacgaaagtgtcgatgatttcgacgaatacgatccaacaccatacggtggtggatacgacattcaccttacctacggtag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3973287 |
tcactcgtggcggaaacggcgacgaaagtgtcgatgatttcgacgaatacgatccaacaccatacggtggtggatacgacattcaccttacctacggtag |
3973188 |
T |
 |
| Q |
121 |
accaattccaccttccgatgaaacatgttacccatcaggttcatcaaacaatgattttgattatgatcgtcctcaatttgaatcttatgctcaaccttct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3973187 |
accaattccaccttccgatgaaacatgttacccatcaggttcatcaaacaatgattttgattatgatcgtcctcaatttgaatcttatgctcaaccttct |
3973088 |
T |
 |
| Q |
221 |
gcttatggtgatgaagctcttgctactgagtatagtagctatgtgagaccgaaacctagacctgcaccttctagttttcaccctgaatc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3973087 |
gcttatggtgatgaagctcttgctactgagtatagtagctatgtgagaccgaaacctagacctgcaccttctagttttcaccctgaatc |
3972999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University