View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4551_low_17 (Length: 215)
Name: NF4551_low_17
Description: NF4551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4551_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 20826592 - 20826486
Alignment:
| Q |
1 |
agtaattcgtcattgggattattgcgatttgggaatatgagtttatgaacatagaaggaacgcggatctggaagaaattttgtggttttgatgagtggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
20826592 |
agtaattcgtcattgggattattgcgatttgggaatatgggtttatgaagatagaaggaacacggatctggaggaaattttgtggttttgatgagtggta |
20826493 |
T |
 |
| Q |
101 |
atttgat |
107 |
Q |
| |
|
||||||| |
|
|
| T |
20826492 |
atttgat |
20826486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University