View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4552-Insertion-5 (Length: 240)
Name: NF4552-Insertion-5
Description: NF4552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4552-Insertion-5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 8 - 186
Target Start/End: Original strand, 6544889 - 6545050
Alignment:
| Q |
8 |
catcacaatttaatgatgaaaacatgaaaaaaccttgatgtcacagctcaggtcgcggtcacggacatttttcataatctttgatagaaatctaaatcac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6544889 |
catcacaatttaatgatgaaaacatgaaaaaaccttgatgtcacggctcaggtcgcggtcacggacatttttcataatctttgatagaaatctaaatcac |
6544988 |
T |
|
| Q |
108 |
ttgtttatagagacactaatattatactatgttatgaaaattgtttgatgtaaacaaaaatttatctcctacacttttg |
186 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6544989 |
ttg-ttatagagacac----------------tatgaaaattgtttgatgtaaacaaaaatttatctcctacacttttg |
6545050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 207 - 240
Target Start/End: Original strand, 6545071 - 6545104
Alignment:
| Q |
207 |
gtatgagttgatcattacttacttgacttaggag |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6545071 |
gtatgagttgatcattacttacttgacttaggag |
6545104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University