View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4552_high_11 (Length: 212)

Name: NF4552_high_11
Description: NF4552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4552_high_11
NF4552_high_11
[»] chr6 (2 HSPs)
chr6 (19-62)||(20023818-20023861)
chr6 (19-62)||(18764384-18764427)


Alignment Details
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 20023861 - 20023818
Alignment:
19 ataattgtatgagataaatttctatgcattgtgagtataacatt 62  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
20023861 ataattgtatgagataaatttctatgcattgtgagtataacatt 20023818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 18764427 - 18764384
Alignment:
19 ataattgtatgagataaatttctatgcattgtgagtataacatt 62  Q
    |||||| |||||||||||||||||||||||||||||||||||||    
18764427 ataattatatgagataaatttctatgcattgtgagtataacatt 18764384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University