View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4552_high_11 (Length: 212)
Name: NF4552_high_11
Description: NF4552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4552_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 20023861 - 20023818
Alignment:
| Q |
19 |
ataattgtatgagataaatttctatgcattgtgagtataacatt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20023861 |
ataattgtatgagataaatttctatgcattgtgagtataacatt |
20023818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 18764427 - 18764384
Alignment:
| Q |
19 |
ataattgtatgagataaatttctatgcattgtgagtataacatt |
62 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18764427 |
ataattatatgagataaatttctatgcattgtgagtataacatt |
18764384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University