View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4552_low_3 (Length: 365)
Name: NF4552_low_3
Description: NF4552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4552_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 348
Target Start/End: Original strand, 10011371 - 10011690
Alignment:
| Q |
19 |
cacagagcttggatttggacaacaatgaggggtgttcatcttttgcagaaaaaataagaaatcctcggtgatcattgaatcgatccaaaacatgtcgtaa |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10011371 |
cacagagcttggatttggacaacaaagaggggtgttcatcttttgcagaaaaaataagaaatcctcggtgatcattgaatcgatccaaaacatgtcgtaa |
10011470 |
T |
 |
| Q |
119 |
atttcgttgttgatgaaggttgatgaaagattctggcggagaacatgcagctatgcagatggcattgaagagttggatagatactgtgttgttgaaccaa |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
10011471 |
atttcgttgttg----------atgaaagattctggcggagaacatgcagctatggagatggcattgaagagttggatggatactgtgctgttgaaccaa |
10011560 |
T |
 |
| Q |
219 |
gggaagagagcactgtgattcctaaagttagcatgggaagaagagctagaatnnnnnnngttatgatagatgctggtttagtgtgtgaacatgcgtggga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10011561 |
gggaagagagcactgtgattcctaaagttagcatgggaagaagagctagaataaaaaaagttatgatagatgctggtttagtgtgtgaacatgcgtggga |
10011660 |
T |
 |
| Q |
319 |
aatagatcaactgcatgttttccatatagt |
348 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
10011661 |
aatagatcagctgcatgttttccatatagt |
10011690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University