View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4553-Insertion-4 (Length: 620)
Name: NF4553-Insertion-4
Description: NF4553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4553-Insertion-4 |
 |  |
|
| [»] scaffold0459 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0459 (Bit Score: 53; Significance: 4e-21; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 525 - 581
Target Start/End: Complemental strand, 9491 - 9435
Alignment:
| Q |
525 |
tagagttaagtgaccatcatttcaataatttataattgaaattatgatttgtttctt |
581 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9491 |
tagagttaagtgaccatcatttcaataattcataattgaaattatgatttgtttctt |
9435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University