View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4553-Insertion-7 (Length: 223)
Name: NF4553-Insertion-7
Description: NF4553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4553-Insertion-7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 111 - 223
Target Start/End: Original strand, 49552362 - 49552474
Alignment:
| Q |
111 |
atctcttaaggtttgattttacaatggaatgaattctattggaaattcgaactaaaataattattgatcagaatttatacacttttgatcgaagtgtgga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49552362 |
atctcttaaggtttgattttacaatggaatgaattctattggaaattctaactaaaataattattgatcagaatttatacacttttgatcgaagtgtgga |
49552461 |
T |
 |
| Q |
211 |
ttatcataactta |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49552462 |
ttatcataactta |
49552474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University