View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4553_high_10 (Length: 244)
Name: NF4553_high_10
Description: NF4553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4553_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 41012169 - 41012391
Alignment:
| Q |
1 |
aaatgcatggtagacccctttatgaaattttctatcactcaaatcatatatagagacttatgcatgctacctccacaggtagacactgccactagtgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41012169 |
aaatgcatggtagacccctttatgaaattttctatcactcaaatcatatatagagacttatgcatgctacctccacaggtagacactgccactagtgaaa |
41012268 |
T |
 |
| Q |
101 |
a-aataaattcattgcaaaaatatcttacccttatacatgcataattagttgtgatttgttgacaatgtaaactttttacaaacaatatgtatcaaaatt |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41012269 |
aaaataaattcattgcaaaaatatcttacccttatacatgcataattagttgtgatttgttgacaatgtaaactttttacgaacaatatgtatcaaaatt |
41012368 |
T |
 |
| Q |
200 |
aaactctacatgtaatatgacaa |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41012369 |
aaactctacatgtaatatgacaa |
41012391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University