View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4553_low_10 (Length: 309)
Name: NF4553_low_10
Description: NF4553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4553_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 14 - 291
Target Start/End: Original strand, 43186018 - 43186297
Alignment:
| Q |
14 |
acctgtgaagagcacaagcctggcacttgttgcnnnnnnnctctaacctctggaaaacctacatcgcagagcggaaaatggttgctaactcaacatttct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
43186018 |
acctgtgaagagcacaagcctggcacttgttgcaaaaaacctctaacctctggaaaacctacatcgcagagtggaaaatggttgctaagtcaacatttct |
43186117 |
T |
 |
| Q |
114 |
tcagatgttatgaagctaaaacaaccactaacatcttagcaattggttttttcaattggtaaatccaacttaagccaaaatgaatggtttaaaaataacc |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186118 |
tcagatgttatgaagctgaaacaaccactaacatcttagcaattggttttttcaattggtaaatccaacttaagccaaaatgaatggtttaaaaataacc |
43186217 |
T |
 |
| Q |
214 |
actgttgtcgattgcagatcgcggagaagagtggtttgcttgaaattggctatgctacgagcta--tacagctgctattt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43186218 |
actgttgtcgattgcagatcgcggagaagagtggtttgcttgaaattggctatgctacgagctatgtacagctgctattt |
43186297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University