View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4553_low_14 (Length: 261)
Name: NF4553_low_14
Description: NF4553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4553_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 13143937 - 13144168
Alignment:
| Q |
20 |
gagaactcccgaattacactggctcacccaccacattctcttcaatttccaagaaaggtggtaaacattcgacgtggtttaccgattcaagagccaaacg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13143937 |
gagaactcccgaattacactggctcacccaccacattctcttcaatttccaaaaaaagtggtaaacattcgacgtggtttaccgattcaagagcgaaacg |
13144036 |
T |
 |
| Q |
120 |
acacattaaagacgctttttgagagacatatgcagattgtcacacctaactttaacaacaaaatggttcacaattggagggcccataattactcacagga |
219 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13144037 |
acacattgaagacgctttttgagagacatatgcagattgtcacacctaactttaacaacaaaatggttcacaattggagggcccgtaattactcacagga |
13144136 |
T |
 |
| Q |
220 |
tcaattgttgtttggttcactagtgccctatg |
251 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |
|
|
| T |
13144137 |
tcaattgttgtttggttcaccaatgccctatg |
13144168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University