View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4553_low_16 (Length: 238)
Name: NF4553_low_16
Description: NF4553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4553_low_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 22791458 - 22791235
Alignment:
| Q |
16 |
atattattgtgggaaaggatccaaaacattatattagctaatttgtcatattttaagttttgaggatagatatatgtatatatttatgtatgtactaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22791458 |
atattattgtgggaaaggatccaaaacattatattagctaatttatcatattttaagttttgaggatagatatatgtatatatttatgtatgtgctaaaa |
22791359 |
T |
 |
| Q |
116 |
tgagtggatgaggttaacttgaatgaaggtc-ttttagggggccggacacaaataaatgctatgaaagctctgagactaagacaatgtctgggttgtttg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22791358 |
tgagtggatgaggttaacttgaatgaaggtctttttagggggccggacacaaataaatgccaagaaagctctgagactaagacaatgtctgggttgtttg |
22791259 |
T |
 |
| Q |
215 |
tgtgttgtcagaacacaaagtgtc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
22791258 |
tgtgttgtcagaacacaaagtgtc |
22791235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University