View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4553_low_6 (Length: 419)
Name: NF4553_low_6
Description: NF4553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4553_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 7421174 - 7421346
Alignment:
| Q |
19 |
atctctacttcaactgtctatccacaagacacaaatatcagttagcatgttttaatcaatgtgtctgtcagttaccaaaaataaggaaagctgtcgtttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7421174 |
atctctacttcaactgtctatccacaagacacaaatatcagttagcatgttttaatcaatgtgtctgtcagttaccaaaaataaggaaagctgtcgtttc |
7421273 |
T |
 |
| Q |
119 |
cctcttcaccttcaatgtgcnnnnnnngt-aaccaaaccaatctcaagaacaaacctaaaccttgttacaccg |
190 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7421274 |
cctcttcaccttcaatgtgcaaaaaaagtaaaccaaaccaatctcaagaacaaaccaaaaccttgttacaccg |
7421346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 97 - 138
Target Start/End: Complemental strand, 13028267 - 13028226
Alignment:
| Q |
97 |
aaataaggaaagctgtcgtttccctcttcaccttcaatgtgc |
138 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
13028267 |
aaataaggaaagttgttgtttccctcttcaccttcaatgtgc |
13028226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 315 - 345
Target Start/End: Original strand, 7421490 - 7421520
Alignment:
| Q |
315 |
agaaaatggcttataatcccaaccttaacaa |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7421490 |
agaaaatggcttataatcccaaccttaacaa |
7421520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University