View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4553_low_7 (Length: 412)
Name: NF4553_low_7
Description: NF4553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4553_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 14 - 247
Target Start/End: Original strand, 2927127 - 2927351
Alignment:
| Q |
14 |
agagaaagaaaaagagaggcgtctccgtacacgtacgtattattgtggaagggtttttagggcttttgaggcataacggtttttatggggtttatgcgct |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2927127 |
agagagagaaaaagagaggcgtctccgtac------gtattattgtggaagggtttt-agggcttttgaggcataacagtttttatggggtttatgcgct |
2927219 |
T |
 |
| Q |
114 |
gatttgacagatttacccnnnnnnnnngacttgagggagaagttaggactgcatatataacgcgtgttaattgccaagcaacaaacacgactccgcaatt |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2927220 |
gatttgacagatttacccttttttt--gacttgagggagaagttaggactgcatatataacgcgtgttaattgccaagcaacaaacacgactccgcaatt |
2927317 |
T |
 |
| Q |
214 |
ttatattttctgctcttgttccttcaaaataata |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2927318 |
ttatattttctgctcttgttccttcaaaataata |
2927351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 300 - 397
Target Start/End: Original strand, 2927408 - 2927505
Alignment:
| Q |
300 |
atacaattaggtggacgttgaaattaccgagactagaatgtaacacagatgctatagcaagattatgaattataattgactttattagcttgtttact |
397 |
Q |
| |
|
|||||||||||||||||| |||| ||| |||| |||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2927408 |
atacaattaggtggacgtagaaaatactgagattagaatgtaacacagatgctctagcaagattatgaattatgattgactttattagcttgtttact |
2927505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University