View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4554-Insertion-6 (Length: 266)
Name: NF4554-Insertion-6
Description: NF4554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4554-Insertion-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 6507913 - 6508134
Alignment:
| Q |
8 |
tgaggttctagaggttgacatggttatgaaaatggtgagaaagtgtccaagggaagaagaatatgacaagtgaattgaggagagagcatagaatagaata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| | ||| | ||| |
|
|
| T |
6507913 |
tgaggttctagaggttgacatggttatgaaaatggtgagaaag--------ggaagaagaatacgacaagtgaattgaggagagagtagaga---gcata |
6508001 |
T |
|
| Q |
108 |
gaatagaatggaagtagtggcaagtcttttaaagacactgacttgatcattgagtgaaggaaaaggacattatgttaatgtcnnnnnnnnaaatgcaaaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
6508002 |
gaatagaatggaagtagtggcaagtcttttaaagacactaacttgatcattgagagaaggaaaaagacattatgttaatgtcttttttttaaaggcaaaa |
6508101 |
T |
|
| Q |
208 |
atatattaaatatcaaaccaatcaagagtacaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6508102 |
atatattaaatatcaaaccaatcaagagtacaa |
6508134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 266
Target Start/End: Original strand, 6508153 - 6508181
Alignment:
| Q |
238 |
caaacaacacaaatacaaactctttttag |
266 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6508153 |
caaacaacacaaatacaaactctttttag |
6508181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University