View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4554-Insertion-7 (Length: 113)
Name: NF4554-Insertion-7
Description: NF4554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4554-Insertion-7 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 4e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 8 - 113
Target Start/End: Complemental strand, 19270212 - 19270107
Alignment:
| Q |
8 |
ttaatatcgtcatcttcttcgtcagaaaggtcgatgacggcagagattggtcgtttgccggacaagcggaatgattcgaggtcgattacttctgccggag |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19270212 |
ttaatatcgtcatcttcttcatcagaaaggtcgatgacggcagagattggtcgtttgccggacaagcggaatgattcgaggtcgattacttctgccggag |
19270113 |
T |
|
| Q |
108 |
ctttgt |
113 |
Q |
| |
|
|||||| |
|
|
| T |
19270112 |
ctttgt |
19270107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 19314488 - 19314407
Alignment:
| Q |
20 |
tcttcttcgtcagaaaggtcgatgacggcagagattggtcgtttgccggacaagcggaatgattcgaggtcgattacttctg |
101 |
Q |
| |
|
|||||||| || ||||||| |||||||| ||||| ||||| |||||||| ||||| || | ||| ||||||||||| |||| |
|
|
| T |
19314488 |
tcttcttcatcggaaaggttgatgacggatgagatgggtcgcttgccggagaagcgaaaagtttcaaggtcgattacctctg |
19314407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University